Dizileme Teknolojileri ve Çıktıları Sequencing Technologies and Outputs

DNA sequencing is the determination of the order of nucleotide bases (A, T, G, C) in a DNA molecule. This technology has become indispensable in many fields, from basic biology research to medical diagnostics. Today's sequencing technologies are divided into three generations.

1st Generation — Sanger Sequencing

The dideoxy chain termination method developed by Frederick Sanger and Alan Coulson in 1975 forms the basis of "first-generation" sequencing. This method yields highly accurate sequences of 700–1000 bp in length.

• Advantages: Very high accuracy (>99.9%), long read length
• Disadvantages: Low throughput, high cost per base
• Applications: Single-gene validation, cloning verification

2nd Generation — NGS (Next-Generation Sequencing)

NGS technologies revolutionized the field by sequencing millions of short DNA fragments simultaneously through massively parallel sequencing. This technology fundamentally transformed the field of bioinformatics.

Illumina Sequencing

The most widely used NGS platform today. It is based on the Sequencing by Synthesis (SBS) principle.

• Read length: 75–300 bp (paired-end)
• Throughput: Up to 300 Gb (NovaSeq 6000)
• Accuracy: ~99.9%
• Applications: WGS, RNA-seq, 16S metagenomics, ChIP-seq

Ion Torrent

A semiconductor chip-based sequencing method that measures the release of hydrogen ions.

• Read length: ~400 bp
• Advantage: Fast run time, compact system

3rd Generation — Long-Read Technologies

Third-generation technologies provide much longer DNA reads through single-molecule sequencing. This enables more accurate resolution of repetitive regions, structural variants, and full-length transcripts.

PacBio (Pacific Biosciences)

• SMRT (Single Molecule Real-Time) Sequencing: The activity of DNA polymerase is monitored in real time
• HiFi Reads: 10–25 kb read length, >99.9% accuracy
• Applications: Full-length genome assembly, epigenomics

Oxford Nanopore Technologies (ONT)

• Principle: Measures changes in electrical current as DNA molecules pass through nanopore channels
• Read length: N50 >100 kb (ultra-long reads)
• MinION: Hand-held portable device, ideal for field use
• Disadvantage: Higher error rate for short reads

FASTQ Format

The standard output format for NGS data. Contains four lines for each sequence:

@SEQ_ID                          # Sequence name (starts with @)
ATGCGATCGATCGATCGATCG           # DNA sequence
+                                # Separator (+)
IIIIIIIIIIIIIIIIIIIII           # Quality scores (ASCII)

Phred Quality Score

The quality score (Q) assigned to each base indicates the probability of an incorrect base call:

• Q10: 10% error probability (90% accuracy)
• Q20: 1% error probability (99% accuracy)
• Q30: 0.1% error probability (99.9% accuracy) — accepted minimum
• Q40: 0.01% error probability (99.99% accuracy)

Formula: Q = -10 × log₁₀(P), where P is the probability of error.

Sequencing Strategies

Whole Genome Sequencing (WGS)

The sequencing of an organism's entire genome. Bacterial genomes are typically 1–10 Mb in size. 50–100× coverage is generally sufficient for microbial WGS.

Amplicon Sequencing (16S rRNA)

Widely used in microbiome studies. The hypervariable regions (V3-V4) of the 16S rRNA gene are sequenced to obtain a bacterial community profile. QIIME2 and DADA2 are the main tools used for these analyses.

Shotgun Metagenomics

The non-selective sequencing of all DNA in an environment. Provides comprehensive information about the entire microbial community.

Paired-End vs Single-End Reads

• Single-end: The DNA fragment is read from only one direction. Cheaper and faster.
• Paired-end: The DNA fragment is read from both ends. Provides better performance in assembly and variant detection.